Product Details

SNP ID: rs9261290
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:30070870 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGGGAGAAGTCAGGAAGTACTGTAG[C/T]AGCTGTAGGGGAGAGAAGATTCTGA
Phenotype: MIM: 606670 MIM: 607524 MIM: 607525 MIM: 615714
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PPP1R11 PubMed Links

Gene Details

Gene: PPP1R11
Gene Name: protein phosphatase 1 regulatory inhibitor subunit 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021959.2	1129	Intron			NP_068778.1
XM_006715174.3	1129	Intron			XP_006715237.1

Gene: RNF39
Gene Name: ring finger protein 39

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025236.3	1129	UTR 3			NP_079512.2
NM_170769.2	1129	UTR 3			NP_739575.2
XM_017011325.1	1129	UTR 3			XP_016866814.1
XM_017011326.1	1129	Intron			XP_016866815.1

Gene: ZNRD1
Gene Name: zinc ribbon domain containing 1

There are no transcripts associated with this gene.

Gene: ZNRD1ASP
Gene Name: zinc ribbon domain containing 1 antisense, pseudogene

There are no transcripts associated with this gene.

View Full Product Details