Product Details

SNP ID
rs35643982
Assay Type
Validated
NCBI dbSNP Submissions
NA
Location
Chr.2:231208216 on Build GRCh38
Set Membership
Validated
Context Sequence [VIC/FAM]
GAAAACCATTGTGTAAAACAGTAGG[C/T]GGATCTTTCAGAGACTCCAAATCAT
Phenotype
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
ARMC9 PubMed Links
Additional Information
For this assay, SNP(s) [rs11558174] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ARMC9
Gene Name
armadillo repeat containing 9
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001271466.2 180 Silent Mutation GGC,GGT G47G NP_001258395.1
NM_001291656.1 180 Silent Mutation GGC,GGT G47G NP_001278585.1
NM_025139.5 180 Silent Mutation GGC,GGT G47G NP_079415.3
XM_011511905.1 180 Silent Mutation GGC,GGT G47G XP_011510207.1
XM_011511906.1 180 Silent Mutation GGC,GGT G47G XP_011510208.1
XM_011511907.1 180 Silent Mutation GGC,GGT G47G XP_011510209.1
XM_011511908.2 180 Silent Mutation GGC,GGT G47G XP_011510210.1
XM_011511909.2 180 Silent Mutation GGC,GGT G47G XP_011510211.1
XM_011511910.1 180 Silent Mutation GGC,GGT G47G XP_011510212.1
XM_011511911.1 180 Silent Mutation GGC,GGT G47G XP_011510213.1
XM_011511912.1 180 Silent Mutation GGC,GGT G47G XP_011510214.1
XM_011511913.2 180 Silent Mutation GGC,GGT G47G XP_011510215.1
XM_011511914.2 180 Silent Mutation GGC,GGT G47G XP_011510216.1
XM_011511915.2 180 Silent Mutation GGC,GGT G47G XP_011510217.1
XM_011511916.2 180 Silent Mutation GGC,GGT G47G XP_011510218.1
XM_011511919.2 180 Intron XP_011510221.1
XM_017005018.1 180 Silent Mutation GGC,GGT G47G XP_016860507.1
XM_017005019.1 180 Silent Mutation GGC,GGT G47G XP_016860508.1
XM_017005020.1 180 Silent Mutation GGC,GGT G47G XP_016860509.1
XM_017005021.1 180 Silent Mutation GGC,GGT G47G XP_016860510.1
XM_017005022.1 180 Silent Mutation GGC,GGT G47G XP_016860511.1
XM_017005023.1 180 Silent Mutation GGC,GGT G47G XP_016860512.1
XM_017005024.1 180 Silent Mutation GGC,GGT G47G XP_016860513.1
XM_017005025.1 180 Silent Mutation GGC,GGT G47G XP_016860514.1
XM_017005026.1 180 Silent Mutation GGC,GGT G47G XP_016860515.1

View Full Product Details