Product Details

SNP ID: rs3767876
Assay Type: Functionally tested
NCBI dbSNP Submissions: 39
Location: Chr.1:25825590 on Build GRCh38
Set Membership: HapMap JSNP
Context Sequence [VIC/FAM]: TTATTTTTATTTAAATCTAAATATA[T/G]TCAAATTTTCAGGTTTGTTTAAAAC
Phenotype: MIM: 606210
Polymorphism: T/G, Transversion substitution
Allele Nomenclature
Literature Links: AUNIP PubMed Links

Gene Details

Gene: AUNIP
Gene Name: aurora kinase A and ninein interacting protein

There are no transcripts associated with this gene.

Gene: LOC646471
Gene Name: uncharacterized LOC646471

There are no transcripts associated with this gene.

Gene: MTFR1L
Gene Name: mitochondrial fission regulator 1 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099625.1		Intron			NP_001093095.1
NM_001099626.1		Intron			NP_001093096.1
NM_001099627.1		Intron			NP_001093097.1
NM_019557.5		Intron			NP_062457.3

Gene: SEPN1
Gene Name: selenoprotein N, 1

There are no transcripts associated with this gene.

View Full Product Details