Product Details
- SNP ID
-
rs1384654
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.14:56813807 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCCACTTGTACAATTATTTTGCTAC[A/G]CATATGAGATATAAGCATTCAGAAG
- Phenotype
-
MIM: 600037
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
OTX2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs143322058] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OTX2
- Gene Name
- orthodenticle homeobox 2
There are no transcripts associated with this gene.
- Gene
- OTX2-AS1
- Gene Name
- OTX2 antisense RNA 1 (head to head)
There are no transcripts associated with this gene.
View Full Product Details