Product Details

SNP ID: rs1044359
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:51371992 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCAGCCCAGGTAGAAGGACCAGGA[A/G]AAGAAGGTCTGGATCTGGGGGTGTG
Phenotype: MIM: 130410 MIM: 154045 MIM: 606008
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CLDND2 PubMed Links

Gene Details

Gene: CLDND2
Gene Name: claudin domain containing 2

There are no transcripts associated with this gene.

Gene: ETFB
Gene Name: electron transfer flavoprotein beta subunit

There are no transcripts associated with this gene.

Gene: LIM2
Gene Name: lens intrinsic membrane protein 2

There are no transcripts associated with this gene.

Gene: NKG7
Gene Name: natural killer cell granule protein 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005601.3	393	Silent Mutation	TTC,TTT	F129F	NP_005592.1
XM_005258955.3	393	Silent Mutation	TTC,TTT	F94F	XP_005259012.1
XM_006723228.3	393	Silent Mutation	TTC,TTT	F80F	XP_006723291.1

View Full Product Details