Product Details
- SNP ID
-
rs78902616
- Assay Type
- Functionally tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.10:133528532 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CACGCTGTACGTGGGCTCGCAGCGC[A/G]TGGTGGTGATGCACGGCTACAAGGC
- Phenotype
-
MIM: 124040
- Polymorphism
- A/G, Transition substitution
- Allele Nomenclature
-
- Literature Links
-
CYP2E1
PubMed Links
- Additional Information
-
The CYP2E1 gene exhibits copy number variation. Individuals may carry extra copies of CYP2E1. CYP2E1 SNP genotyping assays run on samples having 2 or more gene copies that are homozygous for the SNP allele will cluster together, and samples having more than 2 gene copies that are heterozygous may run between the 2 copy heterozygous and homozygous clusters. For accurate CYP2E1 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
Gene Details
- Gene
- CYP2E1
- Gene Name
- cytochrome P450 family 2 subfamily E member 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_000773.3 |
262 |
Missense Mutation |
ATG,GTG |
M77V |
NP_000764.1 |
View Full Product Details