Product Details

SNP ID: rs76390746
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:113185956 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCGCCCTCACCGACGGGTCCAGAC[C/G]TGGTGGGAAGAAGGTGCGGGGACGG
Phenotype: MIM: 611665
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: DDX54 PubMed Links

Gene Details

Gene: DDX54
Gene Name: DEAD-box helicase 54

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001111322.1	411	Intron			NP_001104792.1
NM_024072.3	411	Intron			NP_076977.3

Gene: IQCD
Gene Name: IQ motif containing D

There are no transcripts associated with this gene.

Gene: RITA1
Gene Name: RBPJ interacting and tubulin associated 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286215.1	411	UTR 5			NP_001273144.1
NM_032848.2	411	UTR 5			NP_116237.1
XM_005253972.2	411	UTR 5			XP_005254029.1

View Full Product Details