Product Details

SNP ID: rs79687861
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:682049 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTACATGGCGGACATGGACGAGCT[C/T]TTTTCTCAGGTGGATGAGAAGAGGA
Phenotype: MIM: 603264 MIM: 613889 MIM: 607207
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: JMJD8 PubMed Links

Gene Details

Gene: JMJD8
Gene Name: jumonji domain containing 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005920.2	1662	UTR 3			NP_001005920.2
NM_001323918.1	1662	UTR 3			NP_001310847.1
NM_001323919.1	1662	UTR 3			NP_001310848.1
NM_001323920.1	1662	UTR 3			NP_001310849.1
NM_001323922.1	1662	UTR 3			NP_001310851.1

Gene: LOC105371184
Gene Name: uncharacterized LOC105371184

There are no transcripts associated with this gene.

Gene: RHBDL1
Gene Name: rhomboid like 1

There are no transcripts associated with this gene.

Gene: RHOT2
Gene Name: ras homolog family member T2

There are no transcripts associated with this gene.

Gene: STUB1
Gene Name: STIP1 homology and U-box containing protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001293197.1	1662	Silent Mutation	CTC,CTT	L142L	NP_001280126.1
NM_005861.3	1662	Silent Mutation	CTC,CTT	L214L	NP_005852.2

Gene: WDR24
Gene Name: WD repeat domain 24

There are no transcripts associated with this gene.

View Full Product Details