Product Details

SNP ID: rs114826857
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100586633 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTCTACCTACCAATAGCATGGGCG[A/G]GAAGGCGGTCCCTTTGCTAAGGAGG
Phenotype: MIM: 609097
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FBXO24 PubMed Links

Gene Details

Gene: FBXO24
Gene Name: F-box protein 24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001163499.1	301	Intron			NP_001156971.1
NM_012172.4	301	Intron			NP_036304.2
NM_033506.2	301	Missense Mutation	GAG,GGG	E3G	NP_277041.1
XM_005250259.3	301	Intron			XP_005250316.1
XM_011516022.1	301	Intron			XP_011514324.1
XM_011516023.2	301	Intron			XP_011514325.1
XM_017011961.1	301	Intron			XP_016867450.1

Gene: LRCH4
Gene Name: leucine rich repeats and calponin homology domain containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001289934.1	301	Intron			NP_001276863.1
NM_002319.4	301	Intron			NP_002310.2

Gene: PCOLCE-AS1
Gene Name: PCOLCE antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details