Product Details

SNP ID: rs112900131
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:11021817 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TACAAGTTTGCTCTGCTGTGTCCTA[A/G]GATTCCAAGTTGATGTGATTATACA
Phenotype: MIM: 168730 MIM: 613961 MIM: 612669
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: PRH1 PubMed Links

Gene Details

Gene: PRH1
Gene Name: proline rich protein HaeIII subfamily 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001291314.1	804	Intron			NP_001278243.1
NM_001291315.1	804	Intron			NP_001278244.1

Gene: PRH1-PRR4
Gene Name: PRH1-PRR4 readthrough

There are no transcripts associated with this gene.

Gene: PRH1-TAS2R14
Gene Name: PRH1-TAS2R14 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001316893.1	804	Intron			NP_001303822.1

Gene: TAS2R19
Gene Name: taste 2 receptor member 19

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_176888.2	804	Missense Mutation			NP_795369.1

Gene: TAS2R31
Gene Name: taste 2 receptor member 31

There are no transcripts associated with this gene.

View Full Product Details