Product Details

SNP ID

rs111987725

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.16:3658136 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTTCTGGCCCCCTGGCTGTCAGTGT[C/T]GCTCCAGGGCCTTGACAAGCAGCTC

Phenotype

MIM: 125505 MIM: 606219

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

DNASE1 PubMed Links

Additional Information

For this assay, SNP(s) [rs2791] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

DNASE1

Gene Name

deoxyribonuclease I

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005223.3	2197	Intron			NP_005214.2
XM_005255148.3	2197	Intron			XP_005255205.1
XM_006720854.3	2197	Intron			XP_006720917.1
XM_011522393.2	2197	Intron			XP_011520695.1
XM_017022992.1	2197	Intron			XP_016878481.1
XM_017022993.1	2197	Intron			XP_016878482.1
XM_017022994.1	2197	Intron			XP_016878483.1
XM_017022995.1	2197	Intron			XP_016878484.1
XM_017022996.1	2197	Intron			XP_016878485.1
XM_017022997.1	2197	Intron			XP_016878486.1
XM_017022998.1	2197	Intron			XP_016878487.1
XM_017022999.1	2197	Intron			XP_016878488.1
XM_017023000.1	2197	Intron			XP_016878489.1
XM_017023001.1	2197	Intron			XP_016878490.1
XM_017023002.1	2197	Intron			XP_016878491.1
XM_017023003.1	2197	Intron			XP_016878492.1
XM_017023004.1	2197	Intron			XP_016878493.1
XM_017023005.1	2197	Intron			XP_016878494.1
XM_017023006.1	2197	Intron			XP_016878495.1
XM_017023007.1	2197	Intron			XP_016878496.1

Gene

TRAP1

Gene Name

TNF receptor associated protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001272049.1	2197	Missense Mutation	CCA,CTA	P650L	NP_001258978.1
NM_016292.2	2197	Missense Mutation	CCA,CTA	P703L	NP_057376.2
XM_011522345.1	2197	Missense Mutation	CCA,CTA	P563L	XP_011520647.1
XM_017022851.1	2197	Missense Mutation	CCA,CTA	P404L	XP_016878340.1

View Full Product Details