Product Details

SNP ID
rs115676768
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.2:109615086 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CCCTTGTGGGGGCTACCGCACAGAG[A/G]CCGGCCCGCCAGAACCTCCGTGACC
Phenotype
MIM: 601181 MIM: 611737
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
RANBP2 PubMed Links
Additional Information
For this assay, SNP(s) [rs72938294] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
RANBP2
Gene Name
RAN binding protein 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_006267.4 753 Intron NP_006258.3
XM_005264002.2 753 Intron XP_005264059.1
XM_005264003.2 753 Intron XP_005264060.1
XM_005264004.2 753 Intron XP_005264061.1
XM_005264005.4 753 Intron XP_005264062.1
XM_005264007.2 753 Intron XP_005264064.1
XM_011511575.2 753 Intron XP_011509877.1
XM_011511576.2 753 Intron XP_011509878.1
XM_011511578.2 753 Intron XP_011509880.1
XM_017004623.1 753 Intron XP_016860112.1
XM_017004624.1 753 Intron XP_016860113.1
XM_017004625.1 753 Intron XP_016860114.1
Gene
SEPT10
Gene Name
septin 10
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001321496.1 753 Intron NP_001308425.1
NM_001321498.1 753 Intron NP_001308427.1
NM_001321499.1 753 Intron NP_001308428.1
NM_001321500.1 753 Intron NP_001308429.1
NM_001321501.1 753 Intron NP_001308430.1
NM_001321502.1 753 Intron NP_001308431.1
NM_001321503.1 753 Intron NP_001308432.1
NM_001321504.1 753 Intron NP_001308433.1
NM_001321505.1 753 Intron NP_001308434.1
NM_001321506.1 753 Intron NP_001308435.1
NM_001321507.1 753 Intron NP_001308436.1
NM_001321508.1 753 Intron NP_001308437.1
NM_001321509.1 753 Intron NP_001308438.1
NM_001321510.1 753 Intron NP_001308439.1
NM_001321511.1 753 Intron NP_001308440.1
NM_001321512.1 753 Intron NP_001308441.1
NM_001321513.1 753 Intron NP_001308442.1
NM_001321514.1 753 Intron NP_001308443.1
NM_001321515.1 753 Intron NP_001308444.1
NM_144710.4 753 Intron NP_653311.1
NM_178584.3 753 Intron NP_848699.1
XM_006712317.1 753 Intron XP_006712380.1
XM_011510698.2 753 Intron XP_011509000.1
XM_011510699.2 753 Intron XP_011509001.1
XM_011510700.2 753 Intron XP_011509002.1
XM_011510701.2 753 Intron XP_011509003.1
XM_011510702.2 753 Intron XP_011509004.1
XM_011510703.2 753 Intron XP_011509005.1
XM_011510704.2 753 Intron XP_011509006.1
Gene
SOWAHC
Gene Name
sosondowah ankyrin repeat domain family member C
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_023016.3 753 Silent Mutation AGA,AGG R199R NP_075392.2

View Full Product Details