Product Details

SNP ID: rs112261029
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:48898097 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGAGTGTATTGGTAACGTTGGGGTG[A/G]GTGCACTCTTTTGGAGCTGGAGGAA
Phenotype: MIM: 300463 MIM: 314375 MIM: 300249
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: PQBP1 PubMed Links

Gene Details

Gene: PQBP1
Gene Name: polyglutamine binding protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001032381.1	47	Intron			NP_001027553.1
NM_001032382.1	47	Intron			NP_001027554.1
NM_001032383.1	47	Intron			NP_001027555.1
NM_001032384.1	47	Intron			NP_001027556.1
NM_001167989.1	47	Intron			NP_001161461.1
NM_001167990.1	47	Intron			NP_001161462.1
NM_001167992.1	47	Intron			NP_001161464.1
NM_005710.2	47	Intron			NP_005701.1
NM_144495.2	47	Intron			NP_652766.1
XM_005272571.3	47	Intron			XP_005272628.1
XM_005272572.4	47	Intron			XP_005272629.1
XM_011543884.2	47	Intron			XP_011542186.1
XM_017029207.1	47	Intron			XP_016884696.1

Gene: SLC35A2
Gene Name: solute carrier family 35 member A2

There are no transcripts associated with this gene.

Gene: TIMM17B
Gene Name: translocase of inner mitochondrial membrane 17 homolog B (yeast)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001167947.2	47	UTR 5			NP_001161419.1
NM_005834.4	47	UTR 5			NP_005825.1

View Full Product Details