Product Details

SNP ID: rs141964850
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:125823722 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGAAGAGGACGAGGTCATTGACGA[A/G]GTGAGAAGGACACGCTCCCCTAGTT
Phenotype: MIM: 611883 MIM: 606938
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BCCIP PubMed Links

Gene Details

Gene: BCCIP
Gene Name: BRCA2 and CDKN1A interacting protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016567.3	188	Silent Mutation	GAA,GAG	E55E	NP_057651.1
NM_078468.2	188	Silent Mutation	GAA,GAG	E55E	NP_510868.1
NM_078469.2	188	Silent Mutation	GAA,GAG	E55E	NP_510869.1

Gene: MIR4484
Gene Name: microRNA 4484

There are no transcripts associated with this gene.

Gene: UROS
Gene Name: uroporphyrinogen III synthase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000375.2	188	Intron			NP_000366.1
NM_001324036.1	188	Intron			NP_001310965.1
NM_001324037.1	188	Intron			NP_001310966.1
NM_001324038.1	188	Intron			NP_001310967.1
NM_001324039.1	188	Intron			NP_001310968.1
XM_005270140.4	188	Intron			XP_005270197.1
XM_011540127.1	188	Intron			XP_011538429.1
XM_017016610.1	188	Intron			XP_016872099.1
XM_017016611.1	188	Intron			XP_016872100.1
XM_017016612.1	188	Intron			XP_016872101.1

View Full Product Details