Product Details

SNP ID: rs141464502
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:65884450 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TACTGATTCAGGAAGAACCGCACGT[C/T]GCTGAGTGGCCAGTGGTCGGAGCGG
Phenotype: MIM: 605360 MIM: 602364 MIM: 608296 MIM: 136515
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC85B PubMed Links

Gene Details

Gene: CCDC85B
Gene Name: coiled-coil domain containing 85B

There are no transcripts associated with this gene.

Gene: CTSW
Gene Name: cathepsin W

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001335.3	1088	Intron			NP_001326.2

Gene: FIBP
Gene Name: FGF1 intracellular binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004214.4	1088	Missense Mutation	AAC,GAC	N316D	NP_004205.2
NM_198897.1	1088	Missense Mutation	AAC,GAC	N323D	NP_942600.1

Gene: FOSL1
Gene Name: FOS like 1, AP-1 transcription factor subunit

There are no transcripts associated with this gene.

View Full Product Details