Product Details
- SNP ID
-
rs144556094
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:56462598 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGTAAAACACAGCCACCATTTTGCC[A/C]TGCTCTACGGATTCCTCAGTGGGTC
- Phenotype
-
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
OR5M3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs1945237] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR5M3
- Gene Name
- olfactory receptor family 5 subfamily M member 3
There are no transcripts associated with this gene.
- Gene
- OR5M9
- Gene Name
- olfactory receptor family 5 subfamily M member 9
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001004743.1 |
804 |
Missense Mutation |
CAG,CAT |
Q268H |
NP_001004743.1 |
View Full Product Details