Product Details

SNP ID

rs145107371

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.11:72110109 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTACCTCATTGACCTCTCCATCATC[C/T]GGTGACTCATTGTAGTCATTCATCT

Phenotype

MIM: 614717 MIM: 613510 MIM: 612414

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

ANAPC15 PubMed Links

Gene Details

Gene

ANAPC15

Gene Name

anaphase promoting complex subunit 15

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278485.1	430	Intron			NP_001265414.1
NM_001278486.1	430	Intron			NP_001265415.1
NM_001278487.1	430	Intron			NP_001265416.1
NM_001278488.1	430	Silent Mutation	CCA,CCG	P99P	NP_001265417.1
NM_001278489.1	430	Intron			NP_001265418.1
NM_001278490.1	430	Intron			NP_001265419.1
NM_001278491.1	430	Silent Mutation	CCA,CCG	P99P	NP_001265420.1
NM_001278492.1	430	Silent Mutation	CCA,CCG	P99P	NP_001265421.1
NM_001278493.1	430	Silent Mutation	CCA,CCG	P99P	NP_001265422.1
NM_001278494.1	430	Silent Mutation	CCA,CCG	P99P	NP_001265423.1
NM_014042.2	430	Intron			NP_054761.1
XM_017017488.1	430	Silent Mutation	CCA,CCG	P99P	XP_016872977.1
XM_017017489.1	430	Silent Mutation	CCA,CCG	P99P	XP_016872978.1
XM_017017490.1	430	Silent Mutation	CCA,CCG	P99P	XP_016872979.1
XM_017017491.1	430	Intron			XP_016872980.1
XM_017017492.1	430	Silent Mutation	CCA,CCG	P99P	XP_016872981.1
XM_017017493.1	430	Intron			XP_016872982.1
XM_017017494.1	430	Silent Mutation	CCA,CCG	P99P	XP_016872983.1
XM_017017495.1	430	Silent Mutation	CCA,CCG	P90P	XP_016872984.1
XM_017017496.1	430	Silent Mutation	CCA,CCG	P99P	XP_016872985.1
XM_017017497.1	430	Silent Mutation	CCA,CCG	P99P	XP_016872986.1

Gene

LAMTOR1

Gene Name

late endosomal/lysosomal adaptor, MAPK and MTOR activator 1

There are no transcripts associated with this gene.

Gene

LRTOMT

Gene Name

leucine rich transmembrane and O-methyltransferase domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145307.4	430	Intron			NP_001138779.1
NM_001145308.4	430	UTR 3			NP_001138780.1
NM_001145309.3	430	UTR 3			NP_001138781.1
NM_001145310.3	430	UTR 3			NP_001138782.1
NM_001205138.3	430	Intron			NP_001192067.1
NM_001271471.2	430	Intron			NP_001258400.1
NM_001318803.1	430	Intron			NP_001305732.1
NM_145309.5	430	Intron			NP_660352.1
XM_006718473.3	430	Intron			XP_006718536.1
XM_006718474.3	430	Intron			XP_006718537.1
XM_011544847.2	430	Intron			XP_011543149.1
XM_011544848.2	430	Intron			XP_011543150.1
XM_017017356.1	430	Intron			XP_016872845.1
XM_017017357.1	430	Intron			XP_016872846.1
XM_017017358.1	430	Intron			XP_016872847.1
XM_017017359.1	430	Intron			XP_016872848.1
XM_017017360.1	430	Intron			XP_016872849.1

View Full Product Details