Product Details

SNP ID
rs141205945
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.12:99648357 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TCAGCAAAAGAGGAGAAGTGATTGA[C/T]GTGCACAACCGTGCCCGAATGGTAA
Phenotype
MIM: 607815
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
ANKS1B PubMed Links
Additional Information
For this assay, SNP(s) [rs11109969] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ANKS1B
Gene Name
ankyrin repeat and sterile alpha motif domain containing 1B
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001204065.1 608 Intron NP_001190994.1
NM_001204066.1 608 Intron NP_001190995.1
NM_001204067.1 608 Intron NP_001190996.1
NM_001204068.1 608 Intron NP_001190997.1
NM_001204069.1 608 Intron NP_001190998.1
NM_001204070.1 608 Intron NP_001190999.1
NM_001204079.1 608 Intron NP_001191008.1
NM_001204080.1 608 Intron NP_001191009.1
NM_001204081.1 608 Intron NP_001191010.1
NM_020140.3 608 Intron NP_064525.1
NM_152788.4 608 Intron NP_690001.3
NM_181670.3 608 Intron NP_858056.2
XM_005269028.4 608 Intron XP_005269085.1
XM_005269029.4 608 Intron XP_005269086.1
XM_005269032.3 608 Intron XP_005269089.1
XM_006719504.3 608 Intron XP_006719567.1
XM_006719505.3 608 Intron XP_006719568.1
XM_006719506.3 608 Intron XP_006719569.1
XM_006719507.3 608 Intron XP_006719570.1
XM_006719508.3 608 Intron XP_006719571.1
XM_006719509.3 608 Intron XP_006719572.1
XM_006719510.3 608 Intron XP_006719573.1
XM_006719512.3 608 Intron XP_006719575.1
XM_006719513.3 608 Intron XP_006719576.1
XM_006719514.3 608 Intron XP_006719577.1
XM_011538571.2 608 Intron XP_011536873.1
XM_017019651.1 608 Intron XP_016875140.1
XM_017019652.1 608 Intron XP_016875141.1
XM_017019653.1 608 Intron XP_016875142.1
XM_017019654.1 608 Intron XP_016875143.1
XM_017019655.1 608 Intron XP_016875144.1
XM_017019656.1 608 Intron XP_016875145.1
XM_017019657.1 608 Intron XP_016875146.1
XM_017019658.1 608 Intron XP_016875147.1
XM_017019659.1 608 Intron XP_016875148.1
XM_017019660.1 608 Intron XP_016875149.1
XM_017019661.1 608 Intron XP_016875150.1
XM_017019662.1 608 Intron XP_016875151.1
XM_017019663.1 608 Intron XP_016875152.1
XM_017019664.1 608 Intron XP_016875153.1
XM_017019665.1 608 Intron XP_016875154.1
Gene
FAM71C
Gene Name
family with sequence similarity 71 member C
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_153364.3 608 Silent Mutation GAC,GAT D61D NP_699195.1

View Full Product Details