Product Details
- SNP ID
-
rs145125600
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.12:48472886 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTAAGAAGCTTGAACTAAGCAGTAA[C/G]AGAGCCTCAGTGGGCCTAGAAGTAT
- Phenotype
-
MIM: 606878
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ANP32D
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs7956679] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ANP32D
- Gene Name
- acidic nuclear phosphoprotein 32 family member D
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_012404.2 |
|
Intron |
|
|
NP_036536.2 |
- Gene
- C12orf54
- Gene Name
- chromosome 12 open reading frame 54
View Full Product Details