Product Details

SNP ID

rs145530655

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.12:99648218 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTACCGTATTACACGGCCCAAAGCA[A/G]CCCCGCAATGGGCATGTTTAACACC

Phenotype

MIM: 607815

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

ANKS1B PubMed Links

Gene Details

Gene

ANKS1B

Gene Name

ankyrin repeat and sterile alpha motif domain containing 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204065.1	469	Intron			NP_001190994.1
NM_001204066.1	469	Intron			NP_001190995.1
NM_001204067.1	469	Intron			NP_001190996.1
NM_001204068.1	469	Intron			NP_001190997.1
NM_001204069.1	469	Intron			NP_001190998.1
NM_001204070.1	469	Intron			NP_001190999.1
NM_001204079.1	469	Intron			NP_001191008.1
NM_001204080.1	469	Intron			NP_001191009.1
NM_001204081.1	469	Intron			NP_001191010.1
NM_020140.3	469	Intron			NP_064525.1
NM_152788.4	469	Intron			NP_690001.3
NM_181670.3	469	Intron			NP_858056.2
XM_005269028.4	469	Intron			XP_005269085.1
XM_005269029.4	469	Intron			XP_005269086.1
XM_005269032.3	469	Intron			XP_005269089.1
XM_006719504.3	469	Intron			XP_006719567.1
XM_006719505.3	469	Intron			XP_006719568.1
XM_006719506.3	469	Intron			XP_006719569.1
XM_006719507.3	469	Intron			XP_006719570.1
XM_006719508.3	469	Intron			XP_006719571.1
XM_006719509.3	469	Intron			XP_006719572.1
XM_006719510.3	469	Intron			XP_006719573.1
XM_006719512.3	469	Intron			XP_006719575.1
XM_006719513.3	469	Intron			XP_006719576.1
XM_006719514.3	469	Intron			XP_006719577.1
XM_011538571.2	469	Intron			XP_011536873.1
XM_017019651.1	469	Intron			XP_016875140.1
XM_017019652.1	469	Intron			XP_016875141.1
XM_017019653.1	469	Intron			XP_016875142.1
XM_017019654.1	469	Intron			XP_016875143.1
XM_017019655.1	469	Intron			XP_016875144.1
XM_017019656.1	469	Intron			XP_016875145.1
XM_017019657.1	469	Intron			XP_016875146.1
XM_017019658.1	469	Intron			XP_016875147.1
XM_017019659.1	469	Intron			XP_016875148.1
XM_017019660.1	469	Intron			XP_016875149.1
XM_017019661.1	469	Intron			XP_016875150.1
XM_017019662.1	469	Intron			XP_016875151.1
XM_017019663.1	469	Intron			XP_016875152.1
XM_017019664.1	469	Intron			XP_016875153.1
XM_017019665.1	469	Intron			XP_016875154.1

Gene

FAM71C

Gene Name

family with sequence similarity 71 member C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153364.3	469	Missense Mutation	AAC,AGC	N15S	NP_699195.1

View Full Product Details