Product Details

SNP ID

rs146401531

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.12:99648206 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GACTGCTGTATGCTACCGTATTACA[C/T]GGCCCAAAGCAGCCCCGCAATGGGC

Phenotype

MIM: 607815

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

ANKS1B PubMed Links

Gene Details

Gene

ANKS1B

Gene Name

ankyrin repeat and sterile alpha motif domain containing 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204065.1	457	Intron			NP_001190994.1
NM_001204066.1	457	Intron			NP_001190995.1
NM_001204067.1	457	Intron			NP_001190996.1
NM_001204068.1	457	Intron			NP_001190997.1
NM_001204069.1	457	Intron			NP_001190998.1
NM_001204070.1	457	Intron			NP_001190999.1
NM_001204079.1	457	Intron			NP_001191008.1
NM_001204080.1	457	Intron			NP_001191009.1
NM_001204081.1	457	Intron			NP_001191010.1
NM_020140.3	457	Intron			NP_064525.1
NM_152788.4	457	Intron			NP_690001.3
NM_181670.3	457	Intron			NP_858056.2
XM_005269028.4	457	Intron			XP_005269085.1
XM_005269029.4	457	Intron			XP_005269086.1
XM_005269032.3	457	Intron			XP_005269089.1
XM_006719504.3	457	Intron			XP_006719567.1
XM_006719505.3	457	Intron			XP_006719568.1
XM_006719506.3	457	Intron			XP_006719569.1
XM_006719507.3	457	Intron			XP_006719570.1
XM_006719508.3	457	Intron			XP_006719571.1
XM_006719509.3	457	Intron			XP_006719572.1
XM_006719510.3	457	Intron			XP_006719573.1
XM_006719512.3	457	Intron			XP_006719575.1
XM_006719513.3	457	Intron			XP_006719576.1
XM_006719514.3	457	Intron			XP_006719577.1
XM_011538571.2	457	Intron			XP_011536873.1
XM_017019651.1	457	Intron			XP_016875140.1
XM_017019652.1	457	Intron			XP_016875141.1
XM_017019653.1	457	Intron			XP_016875142.1
XM_017019654.1	457	Intron			XP_016875143.1
XM_017019655.1	457	Intron			XP_016875144.1
XM_017019656.1	457	Intron			XP_016875145.1
XM_017019657.1	457	Intron			XP_016875146.1
XM_017019658.1	457	Intron			XP_016875147.1
XM_017019659.1	457	Intron			XP_016875148.1
XM_017019660.1	457	Intron			XP_016875149.1
XM_017019661.1	457	Intron			XP_016875150.1
XM_017019662.1	457	Intron			XP_016875151.1
XM_017019663.1	457	Intron			XP_016875152.1
XM_017019664.1	457	Intron			XP_016875153.1
XM_017019665.1	457	Intron			XP_016875154.1

Gene

FAM71C

Gene Name

family with sequence similarity 71 member C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153364.3	457	Missense Mutation	ACG,ATG	T11M	NP_699195.1

View Full Product Details