Product Details

SNP ID: rs149168717
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:120446690 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGGATCACGGCTGCGGTGATCGAG[C/T]ACCTGGAGCGTCTAGCGCTTGTGGA
Phenotype: MIM: 602072 MIM: 614943
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: COX6A1 PubMed Links

Gene Details

Gene: COX6A1
Gene Name: cytochrome c oxidase subunit 6A1

There are no transcripts associated with this gene.

Gene: GATC
Gene Name: glutamyl-tRNA amidotransferase subunit C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_176818.2	158	Missense Mutation	CAC,TAC	H39Y	NP_789788.1

Gene: TRIAP1
Gene Name: TP53 regulated inhibitor of apoptosis 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016399.2	158	Intron			NP_057483.1

View Full Product Details