Product Details

SNP ID

rs150228563

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.12:99648642 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TTTATCTTCAGCTGTGTCCTCCATC[C/G]GATGCAAGTGAAGACCTTTTTGTTC

Phenotype

MIM: 607815

Polymorphism

C/G, Transversion substitution

Allele Nomenclature

Literature Links

ANKS1B PubMed Links

Gene Details

Gene

ANKS1B

Gene Name

ankyrin repeat and sterile alpha motif domain containing 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204065.1	893	Intron			NP_001190994.1
NM_001204066.1	893	Intron			NP_001190995.1
NM_001204067.1	893	Intron			NP_001190996.1
NM_001204068.1	893	Intron			NP_001190997.1
NM_001204069.1	893	Intron			NP_001190998.1
NM_001204070.1	893	Intron			NP_001190999.1
NM_001204079.1	893	Intron			NP_001191008.1
NM_001204080.1	893	Intron			NP_001191009.1
NM_001204081.1	893	Intron			NP_001191010.1
NM_020140.3	893	Intron			NP_064525.1
NM_152788.4	893	Intron			NP_690001.3
NM_181670.3	893	Intron			NP_858056.2
XM_005269028.4	893	Intron			XP_005269085.1
XM_005269029.4	893	Intron			XP_005269086.1
XM_005269032.3	893	Intron			XP_005269089.1
XM_006719504.3	893	Intron			XP_006719567.1
XM_006719505.3	893	Intron			XP_006719568.1
XM_006719506.3	893	Intron			XP_006719569.1
XM_006719507.3	893	Intron			XP_006719570.1
XM_006719508.3	893	Intron			XP_006719571.1
XM_006719509.3	893	Intron			XP_006719572.1
XM_006719510.3	893	Intron			XP_006719573.1
XM_006719512.3	893	Intron			XP_006719575.1
XM_006719513.3	893	Intron			XP_006719576.1
XM_006719514.3	893	Intron			XP_006719577.1
XM_011538571.2	893	Intron			XP_011536873.1
XM_017019651.1	893	Intron			XP_016875140.1
XM_017019652.1	893	Intron			XP_016875141.1
XM_017019653.1	893	Intron			XP_016875142.1
XM_017019654.1	893	Intron			XP_016875143.1
XM_017019655.1	893	Intron			XP_016875144.1
XM_017019656.1	893	Intron			XP_016875145.1
XM_017019657.1	893	Intron			XP_016875146.1
XM_017019658.1	893	Intron			XP_016875147.1
XM_017019659.1	893	Intron			XP_016875148.1
XM_017019660.1	893	Intron			XP_016875149.1
XM_017019661.1	893	Intron			XP_016875150.1
XM_017019662.1	893	Intron			XP_016875151.1
XM_017019663.1	893	Intron			XP_016875152.1
XM_017019664.1	893	Intron			XP_016875153.1
XM_017019665.1	893	Intron			XP_016875154.1

Gene

FAM71C

Gene Name

family with sequence similarity 71 member C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153364.3	893	Silent Mutation	TCC,TCG	S156S	NP_699195.1

View Full Product Details