Product Details

SNP ID: rs139267307
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:77275773 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAAGTCAAAAGGGCTGTAGCAGTG[A/G]GAAAGGGAGGTCATCGGGCCCCAGA
Phenotype: MIM: 605304 MIM: 607439
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR1260A PubMed Links

Gene Details

Gene: MIR1260A
Gene Name: microRNA 1260a

There are no transcripts associated with this gene.

Gene: NGB
Gene Name: neuroglobin

There are no transcripts associated with this gene.

Gene: POMT2
Gene Name: protein O-mannosyltransferase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013382.5	4159	UTR 3			NP_037514.2
XM_011536675.2	4159	UTR 3			XP_011534977.1
XM_011536676.2	4159	UTR 3			XP_011534978.1
XM_011536677.2	4159	UTR 3			XP_011534979.1
XM_011536679.2	4159	UTR 3			XP_011534981.1
XM_017021244.1	4159	UTR 3			XP_016876733.1
XM_017021245.1	4159	UTR 3			XP_016876734.1

View Full Product Details