Product Details

SNP ID

rs148657945

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.14:21058000 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGCCCAAGGACATGACATCATCTCA[A/G]TGGTTTAAAACTCAGCATGTGCAGC

Phenotype

MIM: 610018 MIM: 605272 MIM: 612485

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ARHGEF40 PubMed Links

Additional Information

For this assay, SNP(s) [rs12435011] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ARHGEF40

Gene Name

Rho guanine nucleotide exchange factor 40

There are no transcripts associated with this gene.

Gene

NDRG2

Gene Name

NDRG family member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282211.1	179	Intron			NP_001269140.1
NM_001282212.1	179	Intron			NP_001269141.1
NM_001282213.1	179	Intron			NP_001269142.1
NM_001282214.1	179	Intron			NP_001269143.1
NM_001282215.1	179	Intron			NP_001269144.1
NM_001282216.1	179	Intron			NP_001269145.1
NM_001320329.1	179	Intron			NP_001307258.1
NM_016250.2	179	Intron			NP_057334.1
NM_201535.1	179	Intron			NP_963293.1
NM_201536.1	179	Intron			NP_963294.1
NM_201537.1	179	Intron			NP_963831.1
NM_201538.1	179	Intron			NP_963832.1
NM_201539.1	179	Intron			NP_963833.1
NM_201540.1	179	Intron			NP_963834.1
NM_201541.1	179	Intron			NP_963835.1
XM_011536996.2	179	Intron			XP_011535298.1
XM_011536997.1	179	Intron			XP_011535299.1
XM_011536998.1	179	Intron			XP_011535300.1
XM_011536999.1	179	Intron			XP_011535301.1
XM_011537001.1	179	Intron			XP_011535303.1
XM_011537002.1	179	Intron			XP_011535304.1
XM_017021480.1	179	Intron			XP_016876969.1
XM_017021481.1	179	Intron			XP_016876970.1
XM_017021482.1	179	Intron			XP_016876971.1
XM_017021483.1	179	Intron			XP_016876972.1
XM_017021484.1	179	Intron			XP_016876973.1
XM_017021485.1	179	Intron			XP_016876974.1
XM_017021486.1	179	Intron			XP_016876975.1
XM_017021487.1	179	Intron			XP_016876976.1
XM_017021488.1	179	Intron			XP_016876977.1
XM_017021489.1	179	Intron			XP_016876978.1
XM_017021490.1	179	Intron			XP_016876979.1
XM_017021491.1	179	Intron			XP_016876980.1
XM_017021492.1	179	Intron			XP_016876981.1
XM_017021493.1	179	Intron			XP_016876982.1
XM_017021494.1	179	Intron			XP_016876983.1
XM_017021495.1	179	Intron			XP_016876984.1
XM_017021496.1	179	Intron			XP_016876985.1
XM_017021497.1	179	Intron			XP_016876986.1

Gene

RNASE8

Gene Name

ribonuclease A family member 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_138331.2	179	Silent Mutation	CAA,CAG	Q36Q	NP_612204.1

View Full Product Details