Product Details

SNP ID: rs111952796
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:52193971 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAATCATTTCCAGAGCATGTGGAGA[A/G]GGGGTAAAAGGAAATGTGACTTGAA
Phenotype: MIM: 604447 MIM: 610022
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GNB5 PubMed Links

Gene Details

Gene: GNB5
Gene Name: G protein subunit beta 5

There are no transcripts associated with this gene.

Gene: LOC100129973
Gene Name: uncharacterized LOC100129973

There are no transcripts associated with this gene.

Gene: MYO5C
Gene Name: myosin VC

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018728.3	5322	Silent Mutation			NP_061198.2
XM_011521781.2	5322	Silent Mutation			XP_011520083.1
XM_017022408.1	5322	Silent Mutation			XP_016877897.1
XM_017022409.1	5322	Silent Mutation			XP_016877898.1
XM_017022410.1	5322	Silent Mutation			XP_016877899.1

View Full Product Details