Product Details
- SNP ID
-
rs141345511
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.15:62067665 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGGTCCTGAGTGCCTTCGGCGGAGC[C/G]GAGACTGGCTTCTCCCGGGTCGGGC
- Phenotype
-
MIM: 610343
MIM: 608879
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
C2CD4A
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs12911068] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C2CD4A
- Gene Name
- C2 calcium dependent domain containing 4A
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_207322.2 |
193 |
Missense Mutation |
CGA,GGA |
R18G |
NP_997205.2 |
- Gene
- LOC101928907
- Gene Name
- uncharacterized LOC101928907
There are no transcripts associated with this gene.
- Gene
- VPS13C
- Gene Name
- vacuolar protein sorting 13 homolog C
There are no transcripts associated with this gene.
View Full Product Details