Product Details

SNP ID

rs139310634

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.16:15038162 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TTTAAAAACATCAAGGTAGATCTAA[C/T]ATGTTCAACAAAGTGGGGTGGCTCA

Phenotype

MIM: 615367 MIM: 614244

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

NTAN1 PubMed Links

Additional Information

For this assay, SNP(s) [rs1136001] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

NTAN1

Gene Name

N-terminal asparagine amidase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270766.1	745	Intron			NP_001257695.1
NM_001270767.1	745	Intron			NP_001257696.1
NM_173474.3	745	Intron			NP_775745.1
XM_011522355.2	745	Missense Mutation	ATT,GTT	I185V	XP_011520657.1

Gene

PDXDC1

Gene Name

pyridoxal dependent decarboxylase domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001285444.1	745	UTR 3			NP_001272373.1
NM_001285445.1	745	UTR 3			NP_001272374.1
NM_001285447.1	745	UTR 3			NP_001272376.1
NM_001285448.1	745	UTR 3			NP_001272377.1
NM_001285449.1	745	Intron			NP_001272378.1
NM_001285450.1	745	Intron			NP_001272379.1
NM_001324019.1	745	UTR 3			NP_001310948.1
NM_001324020.1	745	Intron			NP_001310949.1
NM_001324021.1	745	Intron			NP_001310950.1
NM_015027.3	745	UTR 3			NP_055842.2
XM_005255173.1	745	Intron			XP_005255230.1
XM_005255176.2	745	Intron			XP_005255233.1
XM_006720865.2	745	Intron			XP_006720928.2
XM_017023059.1	745	Intron			XP_016878548.1
XM_017023060.1	745	Intron			XP_016878549.1
XM_017023061.1	745	Intron			XP_016878550.1
XM_017023062.1	745	Intron			XP_016878551.1
XM_017023063.1	745	Intron			XP_016878552.1
XM_017023064.1	745	Intron			XP_016878553.1
XM_017023065.1	745	Intron			XP_016878554.1

View Full Product Details