Product Details

SNP ID: rs147086833
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:685171 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGGTCGATGTAGGAAGTGTACCA[C/G]TGCTCCTGGGGGAGGGAGCGCCCGG
Phenotype: MIM: 609082 MIM: 603264 MIM: 607207
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FBXL16 PubMed Links

Gene Details

Gene: FBXL16
Gene Name: F-box and leucine rich repeat protein 16

There are no transcripts associated with this gene.

Gene: JMJD8
Gene Name: jumonji domain containing 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005920.2	3313	Intron			NP_001005920.2
NM_001323918.1	3313	Intron			NP_001310847.1
NM_001323919.1	3313	Intron			NP_001310848.1
NM_001323920.1	3313	Intron			NP_001310849.1
NM_001323922.1	3313	Intron			NP_001310851.1

Gene: LOC105371184
Gene Name: uncharacterized LOC105371184

There are no transcripts associated with this gene.

Gene: RHBDL1
Gene Name: rhomboid like 1

There are no transcripts associated with this gene.

Gene: STUB1
Gene Name: STIP1 homology and U-box containing protein 1

There are no transcripts associated with this gene.

Gene: WDR24
Gene Name: WD repeat domain 24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032259.3	3313	Missense Mutation	CAC,CAG	H675Q	NP_115635.1
XM_011522699.2	3313	Missense Mutation	CAC,CAG	H764Q	XP_011521001.1

View Full Product Details