Product Details

SNP ID: rs147870961
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:1827796 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTTGGAAGAAGGAGATATTATCTT[A/G]ACTGGGACGCCAAAGGGAGTTGGAC
Phenotype: MIM: 616320 MIM: 138760
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAHD1 PubMed Links

Gene Details

Gene: FAHD1
Gene Name: fumarylacetoacetate hydrolase domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001018104.2	573	Silent Mutation	TTA,TTG	L189L	NP_001018114.1
NM_001142398.1	573	Silent Mutation	TTA,TTG	L189L	NP_001135870.1
NM_031208.3	573	Intron			NP_112485.1

Gene: HAGH
Gene Name: hydroxyacylglutathione hydrolase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040427.1	573	Intron			NP_001035517.1
NM_001286249.1	573	Intron			NP_001273178.1
NM_005326.4	573	Intron			NP_005317.2
XM_011522469.2	573	Intron			XP_011520771.1
XM_011522470.2	573	Intron			XP_011520772.1
XM_017023195.1	573	Intron			XP_016878684.1

Gene: MEIOB
Gene Name: meiosis specific with OB domains

There are no transcripts associated with this gene.

View Full Product Details