Product Details

SNP ID: rs149692669
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:69329134 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCGTGCTGGATGATGCGGGCTGCC[C/T]ACCCGCTCGCCTGCCACACCACCTG
Phenotype: MIM: 606979 MIM: 609982
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: COG8 PubMed Links

Gene Details

Gene: COG8
Gene Name: component of oligomeric golgi complex 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032382.4	645	UTR 3			NP_115758.3

Gene: PDF
Gene Name: peptide deformylase (mitochondrial)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022341.1	645	Nonsense Mutation	TAG,TGG	*207W	NP_071736.1

Gene: VPS4A
Gene Name: vacuolar protein sorting 4 homolog A

There are no transcripts associated with this gene.

View Full Product Details