Product Details

SNP ID: rs138302461
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:51168273 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAAGAACACCTGAAGCAGCACTACA[C/T]TGACCTGAAAGACCGACCATTCTTC
Phenotype: MIM: 156490 MIM: 156491
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MBTD1 PubMed Links

Gene Details

Gene: MBTD1
Gene Name: mbt domain containing 1

There are no transcripts associated with this gene.

Gene: NME1
Gene Name: NME/NM23 nucleoside diphosphate kinase 1

There are no transcripts associated with this gene.

Gene: NME1-NME2
Gene Name: NME1-NME2 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001018136.2	388	Missense Mutation	ACT,ATT	T168I	NP_001018146.1

Gene: NME2
Gene Name: NME/NM23 nucleoside diphosphate kinase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001018137.2	388	Missense Mutation	ACT,ATT	T53I	NP_001018147.1
NM_001018138.1	388	Intron			NP_001018148.1
NM_001018139.2	388	Intron			NP_001018149.1
NM_001198682.1	388	Missense Mutation	ACT,ATT	T53I	NP_001185611.1
NM_002512.3	388	Missense Mutation	ACT,ATT	T53I	NP_002503.1

View Full Product Details