Product Details

SNP ID: rs138550949
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:2042763 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAACAGGCTGGGGCCTTTTGACGGC[C/T]TTCTTGGTTTCAGCCAAGGGGCTGC
Phenotype: MIM: 603527 MIM: 610016 MIM: 613487 MIM: 607896
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DPH1 PubMed Links

Gene Details

Gene: DPH1
Gene Name: diphthamide biosynthesis 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001383.3	1527	UTR 3			NP_001374.3

Gene: MIR132
Gene Name: microRNA 132

There are no transcripts associated with this gene.

Gene: MIR212
Gene Name: microRNA 212

There are no transcripts associated with this gene.

Gene: OVCA2
Gene Name: ovarian tumor suppressor candidate 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_080822.2	1527	Missense Mutation	CTT,TTT	L115F	NP_543012.1

View Full Product Details