Product Details
- SNP ID
-
rs140667731
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:41524478 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCAGGATCTTGGCGAGATCGGTGCC[C/T]GGAGCGGAATCCACCTCCACACTGA
- Phenotype
-
MIM: 148030
MIM: 148020
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
KRT15
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs1869720] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KRT15
- Gene Name
- keratin 15
There are no transcripts associated with this gene.
- Gene
- KRT19
- Gene Name
- keratin 19
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_002276.4 |
|
Intron |
|
|
NP_002267.2 |
- Gene
- MIR6510
- Gene Name
- microRNA 6510
There are no transcripts associated with this gene.
View Full Product Details