Product Details

SNP ID: rs140985834
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:28856386 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AACACTCTCCAACCAGCTACTGGGC[C/T]GAAAGGTATGCTACACCCTTGACCA
Phenotype: MIM: 607435 MIM: 612070 MIM: 612071
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ERAL1 PubMed Links

Gene Details

Gene: ERAL1
Gene Name: Era like 12S mitochondrial rRNA chaperone 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317985.1	484	Nonsense Mutation	CGA,TGA	R136*	NP_001304914.1
NM_001317986.1	484	Nonsense Mutation	CGA,TGA	R136*	NP_001304915.1
NM_005702.3	484	Nonsense Mutation	CGA,TGA	R136*	NP_005693.1

Gene: FAM222B
Gene Name: family with sequence similarity 222 member B

There are no transcripts associated with this gene.

Gene: MIR144
Gene Name: microRNA 144

There are no transcripts associated with this gene.

Gene: MIR451A
Gene Name: microRNA 451a

There are no transcripts associated with this gene.

Gene: MIR451B
Gene Name: microRNA 451b

There are no transcripts associated with this gene.

Gene: MIR4732
Gene Name: microRNA 4732

There are no transcripts associated with this gene.

View Full Product Details