Product Details

SNP ID: rs141505217
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:47847393 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCGGCCTTGCCCTCTCCCGAGGCC[A/G]CCCCAGCCGCCTCCTCCTTGGCGCC
Phenotype: MIM: 614966 MIM: 608613
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LRRC46 PubMed Links

Gene Details

Gene: LRRC46
Gene Name: leucine rich repeat containing 46

There are no transcripts associated with this gene.

Gene: SCRN2
Gene Name: secernin 2

There are no transcripts associated with this gene.

Gene: SP6
Gene Name: Sp6 transcription factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001258248.1	1278	Missense Mutation	GCG,GTG	A346V	NP_001245177.1
NM_199262.2	1278	Missense Mutation	GCG,GTG	A346V	NP_954871.1
XM_006722115.3	1278	Missense Mutation	GCG,GTG	A346V	XP_006722178.1

View Full Product Details