Product Details

SNP ID

rs141718604

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.17:68271605 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CAATGTTTAACTGTAGTAGGCCCAC[A/G]AAGAGGAGGCTGTATCTCCAGCCAA

Phenotype

MIM: 610008 MIM: 603880

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ARSG PubMed Links

Additional Information

For this assay, SNP(s) [rs7222013] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ARSG

Gene Name

arylsulfatase G

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267727.1	868	Intron			NP_001254656.1
NM_014960.4	868	Intron			NP_055775.2
XM_005257170.3	868	Intron			XP_005257227.1
XM_005257172.3	868	Intron			XP_005257229.1
XM_006721777.3	868	Intron			XP_006721840.2
XM_006721779.3	868	Intron			XP_006721842.1
XM_011524535.2	868	Intron			XP_011522837.1
XM_011524536.2	868	Intron			XP_011522838.1
XM_011524537.1	868	Intron			XP_011522839.1
XM_011524538.2	868	Intron			XP_011522840.1
XM_011524540.2	868	Intron			XP_011522842.1
XM_011524541.2	868	Intron			XP_011522843.1
XM_011524542.2	868	Intron			XP_011522844.1
XM_011524543.2	868	Intron			XP_011522845.1
XM_011524544.2	868	Intron			XP_011522846.1
XM_011524545.2	868	Intron			XP_011522847.1
XM_011524546.2	868	Intron			XP_011522848.1
XM_017024360.1	868	Intron			XP_016879849.1
XM_017024361.1	868	Intron			XP_016879850.1
XM_017024362.1	868	Intron			XP_016879851.1
XM_017024363.1	868	Intron			XP_016879852.1
XM_017024364.1	868	Intron			XP_016879853.1
XM_017024365.1	868	Intron			XP_016879854.1
XM_017024366.1	868	Intron			XP_016879855.1
XM_017024367.1	868	Intron			XP_016879856.1
XM_017024368.1	868	Intron			XP_016879857.1

Gene

SLC16A6

Gene Name

solute carrier family 16 member 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001174166.1	868	Silent Mutation	TTC,TTT	F185F	NP_001167637.1
NM_004694.4	868	Silent Mutation	TTC,TTT	F185F	NP_004685.2
XM_005257789.3	868	Silent Mutation	TTC,TTT	F189F	XP_005257846.2
XM_011525461.2	868	Silent Mutation	TTC,TTT	F185F	XP_011523763.1
XM_017025291.1	868	Silent Mutation	TTC,TTT	F185F	XP_016880780.1
XM_017025292.1	868	Silent Mutation	TTC,TTT	F185F	XP_016880781.1

View Full Product Details