Product Details

SNP ID: rs141888599
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:16441195 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGGAATGAATAAACAGCTGATCTT[G/T]TTAAAACTCGCTTCAAAAAAAAAAG
Phenotype: MIM: 606676
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: LRRC75A PubMed Links

Gene Details

Gene: LRRC75A
Gene Name: leucine rich repeat containing 75A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001113567.2		Intron			NP_001107039.1
NM_207387.3		Intron			NP_997270.2
XM_011523845.2		Intron			XP_011522147.1
XM_017024619.1		Intron			XP_016880108.1
XM_017024620.1		Intron			XP_016880109.1

Gene: LRRC75A-AS1
Gene Name: LRRC75A antisense RNA 1

There are no transcripts associated with this gene.

Gene: SNORD49A
Gene Name: small nucleolar RNA, C/D box 49A

There are no transcripts associated with this gene.

Gene: SNORD49B
Gene Name: small nucleolar RNA, C/D box 49B

There are no transcripts associated with this gene.

Gene: SNORD65
Gene Name: small nucleolar RNA, C/D box 65

There are no transcripts associated with this gene.

Gene: TRPV2
Gene Name: transient receptor potential cation channel subfamily V member 2

There are no transcripts associated with this gene.

View Full Product Details