Product Details

SNP ID: rs141992223
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:63881141 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATACTTCTGCTCCTTCAGGATATAG[G/T]CTTCTTCCTAGGAGAAGGACCGCCC
Phenotype: MIM: 118820 MIM: 139240
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CSH2 PubMed Links

Gene Details

Gene: CSH2
Gene Name: chorionic somatomammotropin hormone 2

There are no transcripts associated with this gene.

Gene: GH2
Gene Name: growth hormone 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002059.4	320	Missense Mutation	GAC,GCC	D60A	NP_002050.1
NM_022556.3	320	Intron			NP_072050.1
NM_022557.3	320	Missense Mutation	GAC,GCC	D60A	NP_072051.1
NM_022558.3	320	Missense Mutation	GAC,GCC	D60A	NP_072052.1

Gene: LOC107987248
Gene Name: intercellular adhesion molecule 1-like

There are no transcripts associated with this gene.

View Full Product Details