Product Details
- SNP ID
-
rs143826965
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:42852542 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGCAAGTACACCACGCCCCTGACCC[A/G]TGGGGTGGACTGCCCCTACTTGGCC
- Phenotype
-
MIM: 602268
MIM: 603735
MIM: 605129
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
AOC2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs33916389,rs33986943] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- AOC2
- Gene Name
- amine oxidase, copper containing 2
There are no transcripts associated with this gene.
- Gene
- AOC3
- Gene Name
- amine oxidase, copper containing 3
- Gene
- PSME3
- Gene Name
- proteasome activator subunit 3
There are no transcripts associated with this gene.
View Full Product Details