Product Details

SNP ID: rs149233371
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:4785994 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCTAGGACGTTCCCGCGCGCGCAG[C/T]GCAGCCTGATCCCATTCAGTGCAGT
Phenotype: MIM: 604657
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GLTPD2 PubMed Links

Gene Details

Gene: GLTPD2
Gene Name: glycolipid transfer protein domain containing 2

There are no transcripts associated with this gene.

Gene: TM4SF5
Gene Name: transmembrane 4 L six family member 5

There are no transcripts associated with this gene.

Gene: VMO1
Gene Name: vitelline membrane outer layer 1 homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001144939.1	336	Missense Mutation	CAC,CGC	H85R	NP_001138411.1
NM_001144940.1	336	Missense Mutation	CAC,CGC	H85R	NP_001138412.1
NM_001144941.1	336	Intron			NP_001138413.1
NM_182566.2	336	Missense Mutation	CAC,CGC	H85R	NP_872372.1

View Full Product Details