Product Details

SNP ID: rs149341691
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:63696536 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGAGCTCCACTGGGGTGGTCCCAA[C/G]AGGGCTGATTTACCAGGGTGGCACT
Phenotype: MIM: 602539 MIM: 608626
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LIMD2 PubMed Links

Gene Details

Gene: LIMD2
Gene Name: LIM domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_030576.3	2578	UTR 3			NP_085053.1
XM_005257703.1	2578	Intron			XP_005257760.1
XM_005257705.3	2578	Intron			XP_005257762.1
XM_006722124.1	2578	Intron			XP_006722187.1

Gene: LOC729683
Gene Name: uncharacterized LOC729683

There are no transcripts associated with this gene.

Gene: MAP3K3
Gene Name: mitogen-activated protein kinase kinase kinase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002401.3	2578	Intron			NP_002392.2
NM_203351.1	2578	Intron			NP_976226.1
XM_005257376.3	2578	Intron			XP_005257433.1
XM_005257377.3	2578	Intron			XP_005257434.1
XM_005257378.2	2578	Intron			XP_005257435.1

Gene: STRADA
Gene Name: STE20-related kinase adaptor alpha

There are no transcripts associated with this gene.

View Full Product Details