Product Details

SNP ID: rs150666101
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.18:47033451 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCCGGAAGCCGCAGGTACTGCTCC[C/T]TCCAAGTTTTGTTTTCCTGTGGCTT
Phenotype: MIM: 614697 MIM: 609522
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KATNAL2 PubMed Links

Gene Details

Gene: KATNAL2
Gene Name: katanin catalytic subunit A1 like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_031303.2	2167	Intron			NP_112593.2
XM_005258357.4	2167	Intron			XP_005258414.1
XM_005258358.4	2167	Intron			XP_005258415.1
XM_005258361.3	2167	Intron			XP_005258418.1
XM_006722554.3	2167	Intron			XP_006722617.1
XM_011526219.2	2167	Intron			XP_011524521.1
XM_011526220.1	2167	Intron			XP_011524522.1
XM_011526221.2	2167	Intron			XP_011524523.1
XM_011526223.2	2167	Intron			XP_011524525.1
XM_017026028.1	2167	Intron			XP_016881517.1
XM_017026029.1	2167	Intron			XP_016881518.1
XM_017026030.1	2167	Intron			XP_016881519.1
XM_017026031.1	2167	Intron			XP_016881520.1
XM_017026032.1	2167	Intron			XP_016881521.1

Gene: TCEB3B
Gene Name: transcription elongation factor B subunit 3B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016427.2	2167	Missense Mutation	AAG,AGG	K605R	NP_057511.2

Gene: TCEB3C
Gene Name: transcription elongation factor B subunit 3C

There are no transcripts associated with this gene.

Gene: TCEB3CL
Gene Name: transcription elongation factor B subunit 3C like

There are no transcripts associated with this gene.

View Full Product Details