Product Details

SNP ID: rs138698847
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:42298584 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGAAATATCCTAGCTACCTACAAG[C/T]GATGGAGCCTAGATTTACCCCAGGA
Phenotype: MIM: 612082 MIM: 603074
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CIC PubMed Links

Gene Details

Gene: CIC
Gene Name: capicua transcriptional repressor

There are no transcripts associated with this gene.

Gene: PAFAH1B3
Gene Name: platelet activating factor acetylhydrolase 1b catalytic subunit 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145939.1		Intron			NP_001139411.1
NM_001145940.1		Intron			NP_001139412.1
NM_002573.3		Intron			NP_002564.1
XM_017026846.1		Intron			XP_016882335.1
XM_017026847.1		Intron			XP_016882336.1
XM_017026848.1		Intron			XP_016882337.1

Gene: PRR19
Gene Name: proline rich 19

There are no transcripts associated with this gene.

View Full Product Details