Product Details

SNP ID: rs140704076
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:5680466 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGGCGCCCCCACGCACCTCATCAG[C/T]GACCACACCCGGGCCACCATGGTCG
Phenotype: MIM: 616658
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C19orf70 PubMed Links

Gene Details

Gene: C19orf70
Gene Name: chromosome 19 open reading frame 70

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001308240.1	431	UTR 5			NP_001295169.1
NM_205767.2	431	Silent Mutation	TCA,TCG	S7S	NP_991330.1
XM_011527675.2	431	Intron			XP_011525977.1
XM_017026248.1	431	Intron			XP_016881737.1

Gene: HSD11B1L
Gene Name: hydroxysteroid 11-beta dehydrogenase 1 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267868.1	431	Intron			NP_001254797.1
NM_001267869.1	431	Intron			NP_001254798.1
NM_001267870.1	431	Intron			NP_001254799.1
NM_001267871.1	431	Intron			NP_001254800.1
NM_198533.2	431	Intron			NP_940935.1
NM_198704.2	431	Intron			NP_941993.1
NM_198705.2	431	Intron			NP_941994.1
NM_198706.2	431	Intron			NP_941995.1
NM_198707.2	431	Intron			NP_941996.1
NM_198708.2	431	Intron			NP_941997.1

Gene: LOC107985320
Gene Name: uncharacterized LOC107985320

There are no transcripts associated with this gene.

Gene: RPL36
Gene Name: ribosomal protein L36

There are no transcripts associated with this gene.

View Full Product Details