Product Details

SNP ID: rs143767613
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:48607028 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGGTGATGGCTCTGCCCCCAGGCA[C/T]GACGGGCGTCAAGGACTGCGTCTTC
Phenotype: MIM: 604179 MIM: 609932 MIM: 604125
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FAM83E PubMed Links

Gene Details

Gene: FAM83E
Gene Name: family with sequence similarity 83 member E

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017708.3	286	Intron			NP_060178.2
XM_005259019.1	286	Intron			XP_005259076.1
XM_011527049.2	286	Intron			XP_011525351.1

Gene: RPL18
Gene Name: ribosomal protein L18

There are no transcripts associated with this gene.

Gene: SPACA4
Gene Name: sperm acrosome associated 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_133498.2	286	Missense Mutation	ACG,ATG	T17M	NP_598005.1

Gene: SULT2B1
Gene Name: sulfotransferase family 2B member 1

There are no transcripts associated with this gene.

View Full Product Details