Product Details

SNP ID: rs145762962
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:42303653 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCATTGTGTTTATGTTTTCAATCC[A/G]CTTTCCTGGAACTGGGCCGGGCACA
Phenotype: MIM: 612082 MIM: 603074
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CIC PubMed Links

Gene Details

Gene: CIC
Gene Name: capicua transcriptional repressor

There are no transcripts associated with this gene.

Gene: PAFAH1B3
Gene Name: platelet activating factor acetylhydrolase 1b catalytic subunit 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145939.1		Intron			NP_001139411.1
NM_001145940.1		Intron			NP_001139412.1
NM_002573.3		Intron			NP_002564.1
XM_017026846.1		Intron			XP_016882335.1
XM_017026847.1		Intron			XP_016882336.1
XM_017026848.1		Intron			XP_016882337.1

Gene: PRR19
Gene Name: proline rich 19

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_199285.2		Intron			NP_954979.2
XM_005258779.4		Intron			XP_005258836.2
XM_005258780.3		Intron			XP_005258837.1
XM_006723154.3		Intron			XP_006723217.1
XM_011526787.1		Intron			XP_011525089.1
XM_011526788.1		Intron			XP_011525090.1
XM_011526789.2		Intron			XP_011525091.1
XM_011526790.2		Intron			XP_011525092.1

Gene: TMEM145
Gene Name: transmembrane protein 145

There are no transcripts associated with this gene.

View Full Product Details