Product Details

SNP ID: rs146670929
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:7632553 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTCACAGACTTGGGAGGACACAGC[C/T]GGAGTGGGGGCCCCCAACCCTACCC
Phenotype: MIM: 614770 MIM: 601717 MIM: 610850
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PCP2 PubMed Links

Gene Details

Gene: PCP2
Gene Name: Purkinje cell protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271830.1		Intron			NP_001258759.1
NM_174895.2		Intron			NP_777555.1
XM_006722639.2		Intron			XP_006722702.1
XM_017026249.1		Intron			XP_016881738.1
XM_017026250.1		Intron			XP_016881739.1
XM_017026251.1		Intron			XP_016881740.1
XM_017026252.1		Intron			XP_016881741.1

Gene: PET100
Gene Name: PET100 homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001171155.1		Intron			NP_001164626.1

Gene: STXBP2
Gene Name: syntaxin binding protein 2

There are no transcripts associated with this gene.

Gene: XAB2
Gene Name: XPA binding protein 2

There are no transcripts associated with this gene.

View Full Product Details