Product Details

SNP ID: rs147027818
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:2426005 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AACTGGGGTCACTAGCTGGGGCTAT[A/G]GCTGTGGCCGGCCCCACTTCCCAGG
Phenotype: MIM: 150341 MIM: 607383 MIM: 610477
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LMNB2 PubMed Links

Gene Details

Gene: LMNB2
Gene Name: lamin B2

There are no transcripts associated with this gene.

Gene: MIR7108
Gene Name: microRNA 7108

There are no transcripts associated with this gene.

Gene: TIMM13
Gene Name: translocase of inner mitochondrial membrane 13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_012458.3	1614	UTR 3			NP_036590.1

Gene: TMPRSS9
Gene Name: transmembrane protease, serine 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_011527978.2	1614	Missense Mutation	AGC,GGC	S1067G	XP_011526280.1
XM_011527980.1	1614	Missense Mutation	AGC,GGC	S664G	XP_011526282.1
XM_011527982.2	1614	Missense Mutation	AGC,GGC	S536G	XP_011526284.1

View Full Product Details