Product Details
- SNP ID
-
rs147204270
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:1031147 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GAGGGACTCACCGGCCTCTCCATCG[G/T]CCCCGACTTCCAGAAGGGCCTGAAG
- Phenotype
-
MIM: 605414
MIM: 602373
MIM: 611011
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ABCA7
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs7247087] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ABCA7
- Gene Name
- ATP binding cassette subfamily A member 7
There are no transcripts associated with this gene.
- Gene
- CNN2
- Gene Name
- calponin 2
- Gene
- RNU6-2
- Gene Name
- RNA, U6 small nuclear 2
There are no transcripts associated with this gene.
- Gene
- TMEM259
- Gene Name
- transmembrane protein 259
There are no transcripts associated with this gene.
View Full Product Details